Brenner |
October 5, 1999 |
DNA extension and analysis with rolling |
primers |
Abstract |
A novel "primer walking" method for DNA repeated cycles nucleotide identificatio advancement along a template by template the invention is providing a set of prim primers" that contain complexity-reducin of primers required for annealing to eve a sequencing template. Another important matic replacement of at least one of the cleotide with its cognate complexity-red Sequencing is initiated by annealing rol terminal nucleotides to a primer binding that only the rolling primer whose termi ent with the template leads to the forma amplifying the double stranded extension terminal nucleotide, and hence its compl by the identity of the amplicon. The pri the successfully amplified polynucleotid oligonucleotide-directed mutagenesis so be selected from the set that forms a pe template at a site which is shifted towa one nucleotide relative to the binding s The steps of selective extension, amplif repeated. In this manner, the primers "r the sequencing process, moving a base at cycle. |
sequencing is provided that comprises n by selective extension and primer mutation. An important feature of ers, referred to herein as "rolling g nucleotides for reducing the number ry possible primer binding site on feature of the invention is the syste- four nucleotides in the target polynu- ucing nucleotide or complement thereof. ling primers differing only in their site of a sequencing template so nal nucleotide forms a perfect complem- tion of an extension product. After product to form an amplicon, the ement in the template, is identified mer binding site of the template of e is then mutated by, for example, that a subsequent rolling primer may rfectly matched duplex with the mutated rds the direction of extension by ite of the previous rolling primer. ication and identification are then oll" along the polynucleotide during a time along the template with each |
Inventors: |
Brenner; Sydney (Cambridge, GB) |
Assignee: |
Lynx Therapeutics, Inc. (Hayward, CA) |
Appl. No.: |
916120 |
Filed: |
August 22, 1997 |
Current U.S. Class: |
435/6; 536/23.1; 536/24.3 |
Intern'l Class: |
C12Q 001/68; C07H 021/02; C07H 021/04; C |
12N 015/00 |
Field of Search: |
435/6 536/23.1,24.3 935/76,77,78 |
References Cited [Referenced By] |
U.S. Patent Documents |
4942124 |
Jul., 1990 |
Church |
435/6. |
5405746 |
Apr., 1995 |
Uhlen |
435/6. |
5407799 |
Apr., 1995 |
Studier |
435/6. |
5427911 |
Jun., 1995 |
Ruano |
435/6. |
5496699 |
Mar., 1996 |
Sorenson |
435/6. |
5554517 |
Sep., 1996 |
Davey et al. |
435/91. |
5780231 |
Jul., 1998 |
Brenner |
435/6. |
Other References |
Sanger et al., PNAS 74(12): 5463-5467 (1 |
977). |
Primary Examiner: Jones; W. Gary |
Assistant Examiner: Whisenant; Ethan |
Attorney, Agent or Firm: Macevicz; Steph |
en C. |
Parent Case Text |
This is a continuation-in-part of U.S. p filed Mar. 5, 1996, now U.S. Pat. No. 5, of U.S. patent application Ser. No. 08/5 Pat. No. 5,763,175. |
atent application Ser. No. 08/611,155 780,231 which is a continuation-in-part 60,313 filed Nov. 17, 1995, now U.S. |
Claims |
I claim: |
1. A method for determining the nucleoti method comprising the steps of: |
de sequence of a polynucleotide, the |
(a) providing a set of first primers, ea a 3'-terminal nucleotide, a template pos region comprising one or more complexity |
ch first primer of the set having itioning segment, and an extension -reducing nucleotides; |
(b) providing a double stranded DNA temp site, a promoter, the polynucleotide, an first primer binding site being capable at least one of the first primers; |
late comprising a first primer binding d a second primer binding site, the of forming an extendable duplex with |
(c) generating a population of RNA trans template with an RNA polymerase that rec |
cripts from the double stranded DNA ognizes the promoter; |
(d) mutating the first primer binding si a first primer forming an extendable dup binding site is shifted one nucleotide i that a single stranded DNA template is f |
te in the RNA transcripts by extending lex therewith, so that the first primer n the direction of extension and so ormed; |
(e) forming an amplicon from the single |
stranded DNA template; |
(f) identifying the 3'-terminal nucleoti form the single stranded DNA template by (g) repeating steps (b) through (f) unti ucleotide is determined. |
de of the first primer extended to the identity of the amplicon; and l the nucleotide sequence of the polyn- |
2. The method of claim 1 wherein said st RNA transcripts includes removing DNA fr |
ep of generating said population of om said population. |
3. The method of claim 2 wherein said am double stranded DNA by a polymerase chai |
plicon is formed by amplifying said n reaction. |
4. The method of claim 3 wherein said on des in said extension region of said fir consisting of 2'-deoxyinosine, 8-oxo-2'- osine. |
e or more complexity-reducing nucleoti- st primers are selected from the group deoxyadenosine, and 8-oxo-2'-deoxyguan- |
5. The method of claim 4 wherein said re RNA transcripts includes treating said p |
moving DNA from said population of opulation with a DNase. |
6. The method of claim 5 wherein said RN |
A polymerase is T7 RNA polymerase. |
Description |
FIELD OF THE INVENTION |
The invention relates generally to a met and more particularly, to a method of ba extensions of an oligonucleotide primer. |
hod of DNA sequencing and analysis, se-by-base sequencing by successive |
BACKGROUND |
Large-scale sequencing projects typicall of progressively smaller clones of porti is to be determined. Genomic DNA is frag ial chromosomes (YACs) or cosmids whose inserted into phage or plasmid vectors f al, Science, 254: 59-67 (1991). Although be carried out by either so-called "dire approaches involve at least one or two l are prepared for sequencing by one or an ination method. |
y involve the generation of libraries ons of the polynucleotide whose sequence mented and inserted into yeast artific- inserts, in turn, are fragmented and or sequencing, e.g. Hunkapiller et large-scale sequencing projects can cted" or "random" strategies, both abor intensive steps where templates other variant of the Sanger chain-term- |
Many proposals have been made for reduci steps. For example, one directed strateg ing with a vector-specific "universal" p of synthesis of a new sequencing primer nce information and subsequent new seque In such a manner, one may "walk" along a with a succession of newly determined pr and subclone the template. A drawback of of acquiring the new primer at each cycl ons. Either the process is rendered into next primer to be synthesized, or the pr need to maintain a library of primers of example, could be more than 1.times.10.s length. A proposal to mitigate this diff primers that are assembled from a librar as pentamers or hexamers, e.g., Kotler e 4241-4245 (1993); Kieleczawa et al, Scie like. But even with hexamers, a library is required. |
ng or eliminating these labor intensive y involves an initial round of sequenc- rimer followed by repetitive cycles generated from the just-acquired seque- nce determination with the new primer. relatively large sequencing template imers without the need to fragment such an approach is the difficulty e for making the next round of extensi- lerably slow while one waits for the ocess is rendered impractical by the every possible sequence which, for up.9 for a primer 15 nucleotides in iculty has been made that calls for y of shorter oligonucleotides, such t al, Proc. Natl. Acad. Sci., 90: nce, 258: 1787-1791 (1992); and the of at least 4096 oligonucleotides |
Besides the problem of template preparat and random approaches employ the Sanger which requires the generation of sets of having a common origin and terminating w are typically separated by high resoluti have the capacity of distinguishing very by no more than a single nucleotide. Unf cal problems have seriously impeded effi hes, either for accommodating longer seq sequencing absent massive capital and la i) the gel electrophoretic separation st ult to automate, and introduces an extra of data, e.g. band broadening due to tem to secondary structure in the DNA sequen the separation gel, and the like; ii) nu such as processivity, fidelity, rate of of chain terminators, and the like, are and analysis of DNA sequencing fragments quantities in spatially overlapping band the labeling moiety is distributed over bands rather than being concentrated in in the case of single-lane fluorescence with suitable emission and absorption pr resolvability, e.g. Trainor, Anal. Bioch al, Biotechniques, 5: 342-348 (1987); Ka 19: 4955-4962 (1991); Fung et al, U.S. P al, Electrophoresis, 12: 623-631 (1991). |
ion, as mentioned above, both directed chain-termination method of sequencing labeled DNA fragments, each fragment ith a known base. The sets of fragments on gel electrophoresis, which must large fragments differing in size ortunately, several significant techni- cient scale-up of Sanger-based approac- uences or for accommodating high-volume bor investment. Such problems include ep which is labor intensive, is diffic- degree of variability in the analysis perature effects, compressions due cing fragments, inhomogeneities in cleic acid polymerases whose properties, polymerization, rate of incorporation often sequence dependent; iii) detection which are typically present in fmol s in a gel; iv) lower signals because the many hundred spatially separated a single homogeneous phase, and v) detection, the availability of dyes operties, quantum yield, and spectral em., 62: 418-426 (1990); Connell et rger et al, Nucleic Acids Research, at. No. 4,855,225; and Nishikawa et |
An important advance in sequencing techn approach was available for sequencing DN tion electrophoretic separations of DNA of templates required in large-scale seq amenable to simultaneous, or parallel, a eotides. |
ology could be made if an alternative A (i) that did not require high resolu- fragments, (ii) that reduced the number uencing projects, and (iii) that was pplication to multiple target polynucl- |
SUMMARY OF THE INVENTION |
An object of my invention is to provide ing the sequence of polynucleotides. |
a new method and approach for determin- |
Another object of my invention is to pro to sequencing that requires fewer primer |
vide a new "primer walking" approach s for implementation. |
Still another object of my invention is ing the number of templates required in |
to provide a method and kits for reduc- large-scale sequencing projects. |
Another object of my invention is to pro patterns of gene expression in normal an |
vide a method for rapidly analyzing d diseased tissues and cells. |
A further object of my invention is to p for simultaneously analyzing and/or sequ of different polynucleotides, such as a library or a sample of fragments from a |
rovide a method, kits, and apparatus encing a population of many thousands sample of polynucleotides from a cDNA segment of genomic DNA. |
Still another object of my invention is for identifying populations of polynucle |
to provide a method, kits, and apparatus otides. |
Another object of my invention is to pro of DNA in a size range corresponding to |
vide a method for sequencing segments typical cosmid or YAC inserts. |
The method of my invention achieves thes cycles nucleotide identification by sele along a template by template mutation. A is providing a set of primers, referred contain complexity-reducing nucleotides required for annealing to every possible template. Another important feature of t ment of at least one of the four nucleot with its cognate complexity-reducing nuc ing is initiated by annealing rolling pr nucleotides to a primer binding site of the rolling primer whose terminal nucleo the template leads to the formation of a the double stranded extension product to tide, and hence its complement in the te of the amplicon. For example, in a simpl may be identified by the presence or abs are used for separate extension and ampl site of the template of the successfully mutated by, for example, oligonucleotide uent rolling primer may be selected from duplex with the mutated template at a si ion of extension by one nucleotide relat rolling primer. The steps of selective e tion are then repeated. In this manner, otide during the sequencing process, mov with each cycle. |
e and other objectives by repeated ctive extension and primer advancement n important feature of the invention to herein as "rolling primers" that for reducing the number of primers primer binding site on a sequencing he invention is the systematic replace- ides in the target polynucleotide leotide or complement thereof. Sequenc- imers differing only in their terminal a sequencing template so that only tide forms a perfect complement with n extension product. After amplifying form an amplicon, the terminal nucleo- mplate, is identified by the identity e embodiment, a terminal nucleotide ence of amplicon in four vessels that ification reactions. The primer binding amplified polynucleotide is then -directed mutagenesis so that a subseq- the set that forms a perfectly matched te which is shifted towards the direct- ive to the binding site of the previous xtension, amplification and identifica- the primers "roll" along the polynucle- ing a base at a time along the template |
Generally, this aspect of my invention i (a) providing a set of primers, i.e. the set having an extension region comprisin nucleotides and a terminal nucleotide; ( primer binding site and the polynucleoti the primer binding site being complement least one primer of the set; (c) anneali binding site, the extension region of th duplex with the template and extending t DNA; (d) amplifying the double stranded the terminal nucleotide of the extension of the amplicon; (f) mutating the primer the primer binding site is shifted one o of extension, thereby effectively shorte one or more nucleotides; and (g) repeati nucleotide sequence of the polynucleotid |
s carried out with the following steps: rolling primers, each primer of the g one or more complexity-reducing b) forming a template comprising a de whose sequence is to be determined, ary to the extension region of at ng a primer from the set to the primer e primer forming a perfectly matched he primer to form a double stranded DNA to form an amplicon; (e) identifying region of the primer by the identity binding site of the template so that r more nucleotides in the direction ning the target polynucleotide by ng steps (c) through (f) until the e is determined. |
An important feature of my invention is to many different polynucleotides in par tags. In accordance with this aspect of of a population is conjugated with an ol sequence information to a tag complement of such complements. That is, a unique t of a population which can be copied and to its complement at a fixed position on a tag hybridizes with its complement, a of the transferred sequence information. are determined by repeated cycles of inf at the positions of the corresponding ta |
the capability of applying the method allel by the use of oligonucleotide my invention, each polynucleotide igonucleotide tag for transferring on a spatially addressable array ag is attached to each polynucleotide used to shuttle sequence information an array of such complements. After signal is generated that is indicative Sequences of the tagged polynucleotides ormation transfer and signal detection g complements. |
At least two major advantages are gained to discrete spatial locations rather tha target polynucleotides to such locations entities so that the kinetics of diffusi favorable. Second, tag loading at the sp be sufficient for detection, while targe to be sufficient for both biochemical pr less tag needs to be loaded on the spati |
by using tags to shuttle information n sorting an entire population of : First, tags are much smaller molecular on and hybridization are much more atially discrete locations only need t polynucleotide loading would need ocessing and detection; thus, far ally discrete sites. |
An important feature of this embodiment of an oligonucleotide tag to each polynu substantially all different polynucleoti more fully below, this is achieved by ta tag-polynucleotide conjugates wherein ea being attached to any polynucleotide. |
of my invention is the attachment cleotide of a population such that des have different tags. As explained king a sample of a full ensemble of ch tag has an equal probability of |
Oligonucleotide tags employed in the inv to complementary oligomeric compounds co binding strength and specificity as comp Such complementary oligomeric compounds ents." Subunits of tag complements may c nucleotide analogs or they may comprise of 3 to 6 nucleotides or analogs thereof a minimally cross-hybridizing set. In su mer of the set and the complement of any at least two mismatches. In other words, idizing set at best forms a duplex havin complement of any other oligomer of the tags available in a particular embodimen per tag and on the length of the subunit from a minimally cross-hybridizing set. generally much less than the number of a the tag, which for a tag n nucleotides l for tag complements include peptide nucl horamidates having a 3'-NHP(.dbd.O)(O.su nucleoside. The latter compounds are ref phosphoramidates. Preferably, both the o complements comprise a plurality of subu ybridizing set consisting of natural oli in length. |
ention are capable of hybridizing nsisting of subunits having enhanced ared to natural oligonucleotides. are referred to herein as "tag complem- onsist of monomers of non-natural oligomers having lengths in the range , the oligomers being selected from ch a set, a duplex made up of an oligo- other oligomer of the set contains an oligomer of a minimally cross-hybr- g at least two mismatches with the same set. The number of oligonucleotide t depends on the number of subunits , when the subunit is an oligomer In the latter case, the number is ll possible sequences the length of ong would be 4.sup.n. Preferred monomers eic acid monomers and nucleoside phosp- p.-)O-5' linkage with its adjacent erred to herein as N3'.O slashed.P5' ligonucleotide tags and their tag nits selected from a minimally cross-h- gonucleotides of 3 to 6 nucleotides |
Generally, this embodiment of my inventi steps: (a) attaching an oligonucleotide polynucleotide of a population to form t that substantially all different polynuc tags attached; (b) labeling each tag acc nucleotides of the respective polynucleo rolling primer; (c) cleaving the tags fr and (d) sorting the labeled tags onto a complements for detection. Preferably, t number of times to uniquely identify eac or to reconstruct a larger polynucleotid In summary, my invention provides a nove sequencing. Moreover, my invention is re and is particularly useful in operations amounts of sequence information, such as DNA fragments, mRNA and/or cDNA fingerpr of gene expression patterns. |
on is carried out by the following tag from a repertoire of tags to each ag-polynucleotide conjugates such leotides have different oligonucleotide ording to the identity of the terminal tides selectively amplified with a om the tag-polynucleotide conjugates; spatially addressable array of tag he process is repeated a sufficient h polynucleotide being sequenced, e from randomly generated fragments. l "primer walking" method for DNA adily automated for parallel application requiring the generation of massive large-scale sequencing of genomic inting, and highly resolved measurements |
BRIEF DESCRIPTION OF THE DRAWINGS |
FIG. 1 diagrammatically illustrates the ing RNA template selection. |
steps of a preferred embodiment employ- |
FIG. 2a diagrammatically illustrates the invention employing simultaneous analysi FIG. 2b illustrates the extension region steps that are selected based on the ide region of the current step. |
steps of a preferred method of the s of multiple tagged polynucleotides. s of rolling primers for subsequent ntity of the rolling primer extension |
FIG. 3 diagrmmatically illustrates an ap on a spatially addressable array of tag |
paratus for detecting labeled tags complements. |
FIGS. 4a and 4b illustrate how a sequenc steps of a preferred embodiment of the m |
ing template changes in successive ethod. |
FIGS. 5a-5c illustrate the affect of dNT of rolling primer extension on an RNA te |
P concentration on the selectivity mplate by reverse transcriptase. |
DEFINITIONS |
"Complement" or "tag complement" as used tags refers to an oligonucleotide to whi hybridizes to form a perfectly matched d specific hybridization results in a trip selected to be either double stranded or are formed, the term "complement" is mea complement of a single stranded oligonuc ement of a double stranded oligonucleoti |
herein in reference to oligonucleotide ch a oligonucleotide tag specifically uplex or triplex. In embodiments where lex, the oligonucleotide tag may be single stranded. Thus, where triplexes nt to encompass either a double stranded leotide tag or a single stranded compl- de tag. |
The term "oligonucleotide" as used herei or modified monomers or linkages, includ des, -anomeric forms thereof, peptide nu capable of specifically binding to a tar pattern of monomer-to-monomer interactio pairing, base stacking, Hoogsteen or rev or the like. Usually monomers are linked thereof to form oligonucleotides ranging e.g. 3-4, to several tens of monomeric u is represented by a sequence of letters, ood that the nucleotides are in 5'.fwdar that "A" denotes deoxyadenosine, "C" den uanosine, and "T" denotes thymidine, unl odiester linkages include phosphorothioa ate, phosphoramidate, and the like. It i when oligonucleotides having natural or e.g. where processing by enzymes is call sting of natural nucleotides are require |
n includes linear oligomers of natural ing deoxyribonucleosides, ribonucleosi- cleic acids (PNAs), and the like, get polynucleotide by way of a regular ns, such as Watson-Crick type of base erse Hoogsteen types of base pairing, by phosphodiester bonds or analogs in size from a few monomeric units, nits. Whenever an oligonucleotide such as "ATGCCTG," it will be underst- w.3' order from left to right and otes deoxycytidine, "G" denotes deoxyg- ess otherwise noted. Analogs of phosph- te, phosphorodithioate, phosphoranilid- s clear to those skilled in the art non-natural nucleotides may be employed, ed for, usually oligonucleotides consi- d. |
"Extendable duplex" in reference to a pr that in a duplex formed by such annealin 3'-penultimate nucleotide of the primer adjacent nucleotides in the template and to permit extension of the primer along term contemplates that there may be mult between the primer and template. |
imer annealing to a template means g the 3'-terminal nucleotide and the form Watson-Crick basepairs with their the duplex is sufficiently stable the template with a polymerase. The iple mismatches in the duplex formed |
"Perfectly matched" in reference to a du eotide strands making up the duplex form one other such that every nucleotide in basepairing with a nucleotide in the oth the pairing of nucleoside analogs, such 2-aminopurine bases, and the like, that triplex, the term means that the triplex and a third strand in which every nucleo Hoogsteen association with a basepair of ely, a "mismatch" in a duplex between a a pair or triplet of nucleotides in the Watson-Crick and/or Hoogsteen and/or rev |
plex means that the poly- or oligonucl- a double stranded structure with each strand undergoes Watson-Crick er strand. The term also comprehends as deoxyinosine, nucleosides with may be employed. In reference to a consists of a perfectly matched duplex tide undergoes Hoogsteen or reverse the perfectly matched duplex. Convers- tag and an oligonucleotide means that duplex or triplex fails to undergo erse Hoogsteen bonding. |
As used herein, "nucleoside" and "nucleo and nucleotides, including 2'-deoxy and in Kornberg and Baker, DNA Replication, "Natural nucleotide" as used herein refe leotides A, C, G, and T. "Analogs" in re tic nucleosides having modified base moi e.g. described by Scheit, Nucleotide Ana Uhlman and Peyman, Chemical Reviews, 90: the only proviso that they are capable o include synthetic nucleosides designed t complexity of probes, increase specifici |
tide" include the natural nucleosides 2'-hydroxyl forms, e.g. as described 2nd Ed. (Freeman, San Francisco, 1992). rs to the four common natural deoxynuc- ference to nucleosides includes synthe- eties and/or modified sugar moieties, logs (John Wiley, New York, 1980); 543-584 (1990), or the like, with f specific hybridization. Such analogs o enhance binding properties, reduce ty, and the like. |
As used herein, "amplicon" means the pro That is, it is a population of identical ded, that are replicated from a few star are produced in a polymerase chain react |
duct of an amplification reaction. polynucleotides, usually double stran- ting sequences. Preferably, amplicons ion (PCR). |
As used herein, "complexity-reducing nuc tural nucleotide (i) that, when paired w nucleotides, can form a duplex of substa of the same duplex containing cognate na nucleotide it replaces, and (ii) that ca the same as its cognate natural nucleoti nucleotides do not display degeneracy or erases. That is, when a complexity-reduc is being copied by a polymerase, the pol at the site of a complexity-reducing nuc educing nucleotide triphosphate is a sub incorporated only at the site of a singl another of its complements, but not both tides are readily tested in straight for melting temperature comparisons, and in polymerizations are checked by conventio of radio-labeled complexity-reducing nuc Nati. Acad. Sci., 44: 633 (1958). Prefer ity," as used herein means that the melt as described in Kawase et al, Nucleic Ac is within twenty percent of that of the nucleotide. |
leotide" refers to a natural or non-na- ith either of more than one natural ntially equivalent stability to that tural nucleotide--i.e. the natural n be processed by enzymes substantially de. Preferably, complexity-reducing ambiguity when processed by DNA polym- ing nucleotide is in a template that ymerase incorporates a unique nucleotide leotide. Likewise, when a complexity-r- strate for a DNA polymerase, it is e kind of nucleotide, i.e. one or . Candidate complexity-reducing nucleo- ward hybridization assays, e.g. with incorporation assays in which test nal sequencing or by incorporation leotides, e.g. Bessman et al, Proc. ably, "substantially equivalent stabil- ing temperature of a test 13-mer duplex, ids Research, 14: 7727-7736 (1986), same duplex containing a natural cognate |
DETAILED DESCRIPTION OF THE INVENTION |
The invention provides a "primer walking a special set of primers are used for te of different primers in the set is minim with complexity-reducing nucleotides and Within each cycle of copying and mutatio is identified and the sequencing templat of the template results from the mutatio of target sequence to a nucleotide of pr |
" approach to DNA sequencing in which mplate copying and mutation. The number ized by a combined use of primers the process of template mutation. n, a nucleotide of the polynucleotide e is shortened by one. The shortening n that, in effect, converts a nucleotide imer binding site. |
In an important aspect, the invention pr numbers of polynucleotides in parallel b sequence information obtained in "bulk" to discrete spatially addressable sites at the spatially addressable sites conve by the oligonucleotide tag. As explained rably carried out by alternating cycles ing the target polynucleotides by use of |
ovides a method of sequencing large y using oligonucleotide tags to shuttle or solution phase biochemical processes on a solid phase. Signals generated y the sequence information carried more fully below, sequencing is prefe- of identifying nucleotides and shorten- rolling primers. |
In one aspect, the oligonucleotide tags of "words" or subunits selected from min its. Subunits of such sets cannot form a of another subunit of the same set with Thus, the sequences of any two oligonucl duplexes will never be "closer" than dif embodiments, sequences of any two oligon be even "further" apart, e.g. by designi such that subunits cannot form a duplex of the same set with less than three mis oligonucleotide tags of the invention an of the natural nucleotides so that they es, such as ligases, polymerases, nuclea like. |
of the invention comprise a plurality imally cross-hybridizing sets of subun- duplex or triplex with the complement less than two mismatched nucleotides. eotide tags of a repertoire that form fering by two nucleotides. In particular ucleotide tags of a repertoire can ng a minimally cross-hybridizing set with the complement of another subunit matched nucleotides, and so on. Usually, d their complements are oligomers may be conveniently processed by enzym- ses, terminal transferases, and the |
In another aspect of the invention, tag nucleotide monomers which encompass a ra for antisense therapeutics that have enh specificity for polynucleotide targets. of "oligonucleotide," the compounds may ations of the natural nucleotides, e.g. moieties, and/or monomer-to-monomer link oligonucleotide loops, oligonucleotide " promote enhanced binding and specificity |
complements consist of non-natural nge of compounds typically developed anced binding strength and enhanced As mentioned above under the definition include a variety of different modific- modification of base moieties, sugar ages. Such compounds also include clamps," and like structures that . |
Rolling Primers |
Preferably, rolling primers are from 15 the following form: |
to 30 nucleotide in length and have |
X.sub.1 X.sub.2. . . X.sub.k YY . . . YN |
where the X.sub.i 's are nucleotides, pr ts; Y's are complexity-reducing nucleoti a terminal nucleotide of either A, C, G, otide, such as deoxyinosine. The segment to herein as the "template positioning s in repetitive subunits so that the prime binding site with the terminal nucleotid of target polynucleotide. Preferably, th that if the primer is out of register by be too unstable to remain annealed to th subunit is from 4 to 8 nucleotides in le below, arranging the template positionin subunits reduces the overall number of p primers. Preferably, the template positi group of no more than two nucleotides, a of a complexity-reducing nucleotide bein the underlined X.sub.k indicates the pos by way of oligonucleotide-directed mutag in Current Protocols in Molecular Biolog The segment YY . . . YN is referred to h the primer, as the primer is extended fr ably, extension is carried out by a poly 5'.fwdarw.3' orientation. However, the o other methods of extension, e.g. by liga U.S. Pat. No. 5,114,839. An important fe only take place when the terminal nucleo pair with the adjacent nucleotide in the ses the minimal number of nucleotides gr duplex with the template, even if there That is, in the preferred embodiments, t and the template must be stable enough t mutagenesis. Preferably, the extension r and most preferably, it comprises 4 nucl from the group consisting of deoxyadenos |
eferably arranged in repetitive subuni- des or their complements; and N is or T, or a complexity -reducing nucle- s of X.sub.i nucleotides, referred egments," are preferably arranged r is properly registered on the primer e juxtaposed with the first nucleotide e repeat subunit is long enough so one or more repeat subunits, it will e template. Preferably, the repeat ngth. As will become more apparent g segment as a series of identical rimers required in a set of rolling oning segments are selected from a t least one of which is a complement g employed. In preferred embodiments, ition at which the template is mutated enesis, e.g. a technique fully described y (John Wiley & Sons, New York, 1995). erein as the "extension region" of om this end along the template. Prefer- merase so that YY . . . YN is in a rientation could be 3'.fwdarw.5' with ting oligonucleotide blocks as described ature of the invention is that extension tide, N, forms a Watson-Crick base template. The extension region compri- eater than two that can form a stable is a mismatch at the X.sub.k position. he duplex between the extension region o carry out the oligonucleotide-directed egion comprises from 3 to 6 nucleotides, eotides. Preferably, Y is selected ine (A) and deoxyinosine (I). |
The number of rolling primers required f on several factors, including the type o employed, the length of the primer, the the repeat subunit length of the templat the following set of primers (SEQ ID NO: positioning segment 18 nucleotides in le A's 6 nucleotides in length. |
or a particular embodiment depends f complexity-reducing nucleotides length of the extension region, and e positioning segment. For example, 1 through SEQ ID NO: 6) has a template ngth made up of subunits of G's and |
____________________________________ |
__ |
Subgroup Rolling Primer Sequence |
____________________________________ |
__ |
(1) GGAAGAGGAAGAGGAAGAYYYN |
(2) GAAGAGGAAGAGGAAG |
AGYYYN |
(3) AAGAGGAAGAGGAAG |
AGGYYYN |
(4) AGAGGAAGAGGAAGA |
GGAYYYN |
(5) GAGGAAGAGGAAGA |
GGAAYYYN |
(6) AGGAAGAGGAAGA |
GGAAGYYYN |
____________________________________ |
__ |
If Y is A or I and N is A, C, I, or T, t includes 192 (=6.times.2.sup.3 .times.4) represents all of the following sequence and III. As can be seen from the above e is available for shifting the primer one ion after any cycle. That is, if a prime in a cycle, the next primer employed wou if a primer from subgroup (6) were emplo would be selected from subgroup (1), and amplify the template, the template is, i in each cycle. |
hen the above set of rolling primers primers. In particular, each "YYY" s: AAA, AAI, AII, AIA, IAI, IAA, IIA, xample, a template positioning segment nucleotide in the direction of extens- r from subgroup (5) were employed ld be selected from subgroup (6), yed in a cycle, the next primer employed so on. When PCR is used to copy and n effect, shortened by one nucleotide |
Alternatively, the binding strength of t by substituting G for I and diaminopurin those immediately adjacent to the termin set of "YYY" sequences include DDA, DDI, In another embodiment, the template posi -reducing analogs for mutating the rolli progresses so that fewer such segments a template positioning segments may be emp converts all template nucleotides to C's in an alternating fashion. Both primer p 1 and C's or A's to C's at position 3, w very stable GC basepairs at either end o p2 contains an additional deoxyinosine w GT dimers. Note that the respective repe out of phase. The deoxyinosine at positi to one that forms a perfectly matched du one nucleotide in the direction of exten of primer p1 and p2 one may cause the pr in each cycle. |
he extension region can be improved e (D) for A in all positions, except al nucleotide. That is, an alternative DGI, DGA, GDI, GDA, GGI, and GGA. tioning segment may contain complexity- ng primer binding site as sequencing re required. For example, the following loyed with an extension region that . ##STR1## Primers p1 and p2 are used 1 and p2 convert C's to A's at position hich maintains the two segments of f the primers when they anneal. Primer ithin an interior segment of repeating at units are exactly one nucleotide on 2 converts the primer binding site plex with primer p1 with a shift of sion. Thus, by alternating the use imer to advance by one nucleotide |
Sequencing with Rolling Primers |
Prior to sequencing, a target polynucleo kinds of nucleotide are substituted with nucleotides. In a preferred embodiment, by replicating the target polynucleotide with dITP. A template for sequencing is polynucleotide to a primer binding site. inserting the target polynucleotide into binding site. Preferably, the primer bin ive to the target polynucleotide so that out with a DNA polymerase. Such insertio a blunt-end-cutting restriction endonucl if the rolling primers described above a three-base sequence adjacent to the begi that is complementary to the primers des referred herein as the "T" primer, is lo polynucleotide so that it can be amplifi can be initiated on such a template (SEQ as shown below, assuming the use of the |
tide is treated so that one or more their cognate complexity-reducing this is conveniently accomplished in a PCR wherein dGTP is replaced then prepared by joining the target Typically, this is accomplished by a vector which carries the primer ding site is in the 3' direction relat- primer extensions can be carried n is conveniently carried out using ease, such as Stu I or Ecl 136 II, re employed. These enzymes leave a nning of the target polynucleotide cribed above. Preferably, a primer, cated at the other end of the target ed by PCR. For example, sequencing ID NO: 9) in four separate reactions primers described above. |
____________________________________ |
______________________________________ |
Reaction 1 |
GGAAGAGGAAGAGGAAGAAIIA. |
fwdarw. |
. . . |
CCTTCTCCTTCTCCTTCTTCCNNNN . . . |
NNNBBBB . . . BB . . . |
Reaction 2 |
GGAAGAGGAAGA |
GGAAGAAIIC.fwdarw. |
. . . |
CCTTCTCCTTCTCCTTCTTCCNNNN . . . |
NNNBBBB . . . BB . . . |
Reaction 3 |
GGAAGAGGAAGAGGAA |
GAAIII.fwdarw. |
. . . CCTT . |
CTCCTTCTCCTTCTTCCNNNN . . . NNNBBBB |
. . BB . . . |
Reaction 4 |
GGAAGAGGAAGAGGAAGAAI |
IT.fwdarw. |
. . . CCTTCTCCT . |
TCTCCTTCTTCCNNNN . . . NNNBBBB . . |
BB . . . |
____________________________________ where "NNNN . . . NNN" represents the ta . BB" represents the complement of a T p the sequences by PCR. The underlined seq of the rolling primers. The template pos arbitrarily chosen to correspond to a pr If it is assumed--to illustrate the meth otide adjacent to the rolling primer bin 1 will result in the formation of an amp the polynucleotide is identified as T. P the primer is extended with a high fidel in the presence of dATP, dCTP, dITP, and It should be understood that selective e a single vessel, for example, if labeled products are separated from the primers feature is that only primers whose termi Crick basepair with the template are ext any single stranded DNA in the reaction stranded nuclease, such as Mung bean nuc ion, the remaining double stranded DNA i of dATP, dCTP, dITP, and dTTP in the pre amplicon. Preferably, this amplification PCR so that there is little or no likeli being produced. |
______________________________________- rget polynucleotide and "BBBB . . rimer binding site for amplifying uences indicate the extension regions itioning segment of the primers was imer from subgroup (1) described above. od--that the sequence of the polynucle- ding site is "TAIC," then only Reaction licon, and the first nucleotide of referably, prior to amplification, ity DNA polymerase, such as Sequenase, dTTP in the preferred embodiments. xtension may also be carried out in primers are employed and the extension that fail to extend. The important nal nucleotide forms a correct Watson-- ended. Preferably, after extension, mixture is digested with a single lease. After such extension and digest- s then amplified, again in the presence ferred embodiments, to produce an is accomplished by 5-10 cycles of hood of anomalous amplification products |
Samples of the amplicon from Reaction 1 new vessels containing following primers |
are removed and aliquotted into four from subgroup (2): |
____________________________________ |
______________________________________ |
Reaction 5 |
GAAGAGGAAGAGGAAGAGIIAA. |
fwdarw. |
. . |
. . CCTTCTCCTTCTCCTTCTTCCTNNN . . |
NNNBBBB . . . BB |
Reaction 6 |
GAAGAGGAAGAGGAAG |
AGIIAC.fwdarw. |
. . . CCTTCTCCTTCTCCTTCTTCCT |
NNN . . . NNNBBBB . . . BB |
Reaction 7 |
GAAGAGGAAGAGGAAGAG |
IIAI.fwdarw. |
. . . CCTTCTCC . . |
TTCTCCTTCTTCCTNNN . . . NNNBBBB . |
BB |
Reaction 8 |
GAAGAGGAAGAGGAAGAGIIA |
T.fwdarw. |
. . . CCTTCTC . |
CTTCTCCTTCTTCCTNNN . . . NNNBBBB . |
. BB |
____________________________________ Since the first nucleotide of the target the previous cycle, one selects primers regions have the form "IIAN," as shown. ned T in the lower strands, which is mut by oligonucleotide-directed mutagenesis. otide directing the mutation of the site converted into a "C" in the amplicons. S target is A, both Reactions 7 and 8 lead amplicon may be sampled for the next cyc eotide is presently being considered. As onal "pooling" step must be carried out simultaneously sequenced. |
______________________________________- polynucleotide was determined in from subgroup (2) whose extension This creates a mismatch at the underli- ated to C in any amplicon produced That is, the primer is the oligonucle- in the amplicon. Thus, the "T" is ince the second nucleotide of the to the production of amplicons. Either le since only a single target polynucl- explained more fully below, an additi- when multiple polynucleotides are |
As before, samples of one of the two amp vessels containing primers from subgroup the form "IAIN". |
licons are distributed into four new (3) with an extension region having |
____________________________________ |
______________________________________ |
Reaction 9 |
AAGAGGAAGAGGAAGAGGIAI |
A.fwdarw. |
. . . CCTTCTCCTTCTCCTTCTCC |
CTANN . . . NNNBBBB . . . BB |
Reaction 10 |
AAGAGGAAGAGGAAGAGG |
IAIC.fwdarw. |
. . . CCTTCTCCT . |
TCTCCTTCTCCCTANN . . . NNNBBBB . . |
BB |
Reaction 11 |
AAGAGGAAGAGGA |
AGAGGIAII.fwdarw. |
. . . CCT |
TCTCCTTCTCCTTCTCCCTANN . . . NNNBBBB |
. . . BB |
Reaction 12 |
AAGAGGAAGAGGA |
AGAGGIAIT.fwdarw. |
. . . CCTTCTCCTT . |
CTCCTTCTCCCTANN . . . NNNBBBB . . |
____________________________________ |
______________________________________ |
BB |
Both Reactions 9 and 10 will produce amp fied as an "I." For the next cycle, this from subgroup (4) having an extension re process is continued. |
licons; thus, the third base is identi- then leads to the selection of primers gion with the form "AIAN," and the |
Sequencing with RNA Template Selection |
A significant increase in selectivity ca and a reverse transcriptase to extend ro comes about in part from the facile remo tion after RNA templates are synthesized is illustrated in FIG. 1. Double strande sequenced is ligated between an RNA poly binding site, e.g. by cloning into an ap nts. Using standard protocols, the vecto template (100) and rolling primer bindin template (100) and binding site are synt such as T7 RNA polymerase. After synthes with a DNase to remove extraneous DNA an the purified RNA the appropriate rolling "first primers," are added (130) and tho the RNA template are extended with a rev on, the RNA is removed by hydrolysis, e. H activity of the reverse transcriptase, amplified, preferably by PCR. Preferably red herein as a "second primer," contain round of transcription; and in further p to the template positioning segment of t |
n be achieved by using an RNA template lling primers. The gain in selectivity val of undesired DNA by nuclease diges- . The general scheme of the embodiment d DNA (dsDNA) template (100) to be merase promoter and a rolling primer propriate vector containing such eleme- r is linearized downstream of dsDNA g site, and RNA copies (120) of dsDNA hesized (110) using an RNA polymerase, is, the reaction mixture is treated d the RNA copies are purified. To primers, referred to herein as the se forming extendable duplexes with erse transcriptase. After such extensi- g. by heating and/or action by RNase and the resulting ssDNA (140) is , one of the primers in the PCR, refer- s the promoter sequence for the next reference, the other primer binds he rolling primer binding site. |
A preferred set of rolling primers, i.e. has the following form: |
first primers, for this embodiment |
X.sub.1 X.sub.2. . . X.sub.k IRZNN |
where X.sub.1 X.sub.2. . . X.sub.k is a
bed above, I is deoxyinosine, R is selec
and diaminopurine ("D"), Z is selected f
oxyadenosine ("oxo-A") and 8-oxo-2-deoxy
from the group consisting of A, C, G, an
of the template is converted to either C
and amplification steps. This is because
oxo-A at the Z position it may pair with
template it only allows incorporation of
selected with oxo-G at the Z position it
when used as a template it only allows i
as a "place saver" which provides a stab
opurine being preferred over T for the g
Finally, I converts T's to C's. Clearly,
When the template positioning segments o
are used, then the total number of rolli
is 128 (=2.times.2.times.2.times.16).
|
template positioning segment as descri-
ted from the group consisting of G
rom the group consisting of 8-oxo-2-de-
guanosine ("oxo-G"), N is selected
d T. In this embodiment, any nucleotide
or T by pairing with Z in the extension
whenever a primer is selected with
either G or T, but when used as a
T. Likewise, whenever a primer is
may pair with either A or C, but
ncorporation of C. R merely serves
le basepair with either T or C (diamin-
reater stability of the TD basepair).
G could be also used at this position.
f primers p1 and p2, described above,
ng primers required for sequencing
|
Rolling primers of the above form are re DNA synthesizer using conventional chemi for the various nucleotide analog, which Glen Research (Sterling, Va.). |
adily synthesized on an automated stries and phosphoramidite monomers are available commercially, e.g. |
Constructing Oligonucleotide Tags from M Subunits |
inimally Cross-Hybridizing Sets of |
As mentioned above, an important embodim eous sequencing of multiple target polyn tags of the type disclosed by Brenner, i and 5,654,413; and in International appl are incorporated by reference. |
ent of the invention includes simultan- ucleotides by way of oligonucleotide n U.S. Pat. Nos. 5,604,097; 5,635,400; ication PCT/US96/09513, which references |
Oligonucleotide tags and their complemen range in length from 12 to 60 nucleotide range in length from 18 to 40 nucleotide they range in length from 25 to 40 nucle from antisense monomers, oligonucleotide range in length from 10 to 40 monomers; length from 12 to 30 monomers. Most pref stranded and specific hybridization occu tag complement. |
ts used in the present method may s or basepairs; more preferably, they s or basepairs; and most preferably, otides or basepairs. When constructed tags and their complements preferably and more preferably, they range in erably, oligonucleotide tags are single rs via Watson-Crick pairing with a |
After chemical synthesis libraries of ta PCR amplicons that include primer bindin ction endonuclease recognition sites to to polynucleotides. Preferably, the comp so that the right and left primers have annealing temperatures. In some embodime and other flanking sequences of the tags the four natural nucleotides in order to exchange reaction to render a construct a selected region. Such reactions usuall activity of a DNA polymerase, such as T4 are described in Sambrook et al, Molecul Harbor Laboratory, New York, 1989). |
gs are conveniently maintained as g regions for amplification and restri- facilitate excision and attachment osition of the primers is selected approximately the same melting and nts, either one or both of the primers consist of three or fewer of the allow the use of a "stripping" and containing a tag single stranded in y employ the 3.fwdarw.5' exonuclease DNA polymerase, or like enzyme, and ar Cloning, Second Edition (Cold Spring |
As mentioned above, an important use of from a target polynucleotide to a solid Preferably, this step is carried out by of a double stranded template, e.g. one separating it from the reaction mixture, tag, and applying it to the solid phase be carried out in a variety of ways usin ques, one of which is exemplified below. labeled in a variety of ways, including of radioactive moieties, fluorescent moi inescent markers, and the like. Many com for labeling DNA and constructing DNA pr labelling tags of the present invention. Nonisotopic DNA Probe Techniques (Academ Handbook of Fluorescent Probes and Resea Eugene, 1992); Keller and Manak, DNA Pro New York, 1993); and Eckstein, editor, O ical Approach (IRL Press, Oxford, 1991); ing and Detection of Biomolecules (Sprin like. |
the tags is for "shuttling" information phase support containing tag complements. excising the tag-containing segment or more restriction endonucleases, denaturing and labelling the excised support for detection. This step can g standard molecular biological techni- Likewise, the excised tags can be the direct or indirect attachment eties, colorimetric moieties, chemilum- prehensive reviews of methodologies obes provide guidance applicable to Such reviews include Kricka, editor, ic Press, San Diego, 1992); Haugland, rch Chemicals (Molecular Probes, Inc., bes, 2nd Edition (Stockton Press, ligonucleotides and Analogues: A Pract- Kessler, editor, Nonradioactive Label- ger-Verlag, Berlin, 1992); and the |
Preferably, the tags are labeled with on disclosed by Menchen et al, U.S. Pat. No onal application PCT/US90/05565. |
e or more fluorescent dyes, e.g. as . 5,188,934; and Begot et al Internati- |
Solid Phase Supports for Tag Complements |
Preferably, detection of sequence inform locations where tags hybridize to their the detection of signals from successive with the same tag complement location th Otherwise, the sequence of signals will the sequence of the polynucleotide corre This requirement is met by providing a s complement. As used herein "spatially ad of a particular tag complement can be re cing operation. Knowledge of the identit it is only important that its location b of tag transfers. Preferably, the region ete, i.e. non-overlapping with regions c so that signal detection is more conveni arrays are constructed by attaching or s phase supports. |
ation takes place at spatially discrete complements. It is important that cycles of tag transfer be associated roughout the sequencing operation. not be a faithful representation of sponding to the tag and tag complement. patially addressable array of tag dressable" means that the location corded and tracked throughout a sequen- y of a tag complement is not crucial; e identifiable from cycle to cycle s containing tag complements are discr- ontaining different tag complements, ent. Generally, spatially addressable ynthesizing tag complements on solid |
Solid phase supports for use with the in forms, including microparticles, beads, chined chips, and the like. Likewise, so may comprise a wide variety of compositi alkanethiolate-derivatized gold, cellulo nked polystyrene, silica gel, polyamide, a population of discrete particles are e coating, or population, of complementary other), or a single or a few supports ar regions each containing a uniform coatin sequences to the same tag (and no other) of the regions may vary according to par regions range in area from several m.sup e.g. 100-500. |
vention may have a wide variety of and membranes, slides, plates, microma- lid phase supports of the invention ons, including glass, plastic, silicon, se, low cross-linked and high cross-li- and the like. Preferably, either mployed such that each has a uniform sequences of the same tag (and no e employed with spacially discrete g, or population, of complementary . In the latter embodiment, the area ticular applications; usually, the .2, e.g. 3-5, to several hundred m.sup.2, |
Tag complements may be used with the sol ized on, or they may be separately synth support for use, e.g. as disclosed by Lu 16: 10861-10880 (1988); Albretsen et al, Wolf et al, Nucleic Acids Research, 15: Nucleic Acids Research, 15: 5353-5372 (1 are synthesized on and used with the sam ise a variety of forms and include a var may comprise microparticles or arrays, o populations of tag complements are synth supports may be used with the invention, controlled pore glass (CPG), highly cros rs, cellulose, nylon, dextran, latex, po in the following exemplary references: M vol. 44 (Academic Press, New York, 1976) and 4,046;720; and Pon, Chapter 19, in A Biology, Vol. 20, (Humana Press, Totowa, further include commercially available n ene beads (e.g. available from Applied B atized magnetic beads; polystyrene graft TentaGel.TM., Rapp Polymere, Tubingen Ge the support characteristics, such as mat the like, and the type of linking moiety under which the tags are used. Exemplary Pon et al, Biotechniques, 6: 768-775 (19 Barany et al, International patent appli J. Chem. Soc. Commun., 1989: 891-893; Da 18: 3813-3821 (1990); Beattie et al, Cli Maskos and Southern, Nucleic Acids Resea like. As described more fully below, whe synthesized on microparticles, populatio a solid phase support to form a spatiall |
id phase support that they are synthes- esized and attached to a solid phase nd et al, Nucleic Acids Research, Anal. Biochem., 189: 40-50 (1990); 2911-2926 (1987); or Ghosh et al, 987). Preferably, tag complements e solid phase support, which may compr- iety of linking moieties. Such supports r matrices, of regions where uniform esized. A wide variety of microparticle including microparticles made of s-linked polystyrene, acrylic copolyme- lyacrolein, and the like, disclosed eth. Enzymol., Section A, pages 11-147, ; U.S. Pat. Nos. 4,678,814; 4,413,070; grawal, editor, Methods in Molecular N.J., 1993). Microparticle supports ucleoside-derivatized CPG and polystyr- iosystems, Foster City, Calif.); deriv- ed with polyethylene glycol (e.g., rmany); and the like. Selection of erial, porosity, size, shape, and employed depends on the conditions linking moieties are disclosed in 88); Webb, U.S. Pat. No. 4,659,774; cation PCT/US91/06103; Brown et al, mha et al, Nucleic Acids Research, nical Chemistry, 39: 719-722 (1993); rch, 20: 1679-1684 (1992); and the n tag complements are attached or ns of microparticles are fixed to y addressable array. |
As mentioned above, tag complements may a few) solid phase support to form an ar tag complements. That is, within each re complement is synthesized. Techniques fo in McGall et al, International applicati Natl. Acad. Sci., 91: 5022-5026 (1994); application PCT/GB89/01114; Maskos and S al, Genomics, 13: 1008-1017 (1992); and Research, 21: 4663-4669 (1993). |
also be synthesized on a single (or ray of regions uniformly coated with gion in such an array the same tag r synthesizing such arrays are disclosed on PCT/US93/03767; Pease et al, Proc. Southern and Maskos, International outhern (cited above); Southern et Maskos and Southern, Nucleic Acids |
Preferably, the invention is implemented coated with complements of the same tag methods of covalently or noncovalently l ces are well known, as exemplified by th Iyer (cited above); Gait, editor, Oligon ach (IRL Press, Oxford, 1984); and the r the size and shape of a microparticle is in the size range of a few, e.g. 1-2, to diameter are preferable, as they facilit of large repertoires of oligonucleotide usage. |
with microparticles or beads uniformly sequence. Microparticle supports and inking oligonucleotides to their surfa- e following references: Beaucage and ucleotide Synthesis: A Practical Appro- eferences cited above. Generally, not critical; however, microparticles several hundred, e.g. 200-1000 m ate the construction and manipulation tags with minimal reagent and sample |
Preferably, commercially available contr supports are employed as solid phase sup come available with base-labile linkers e.g. Applied Biosystems (Foster City, Ca having pore size between 500 and 1000 an |
olled-pore glass (CPG) or polystyrene ports in the invention. Such supports and initial nucleosides attached, lif.). Preferably, microparticles gstroms are employed. |
In other preferred applications, non-por their optical properties, which may be a numbers of microparticles on planar supp Particularly preferred non-porous microp (GMA) beads available from Bangs Laborat les are useful in a variety of sizes and groups for synthesizing tags or tag comp parallel manipulations of tagged micropa employed. |
ous microparticles are employed for dvantageously used when tracking large orts, such as a microscope slide. articles are the glycidal methacrylate ories (Carmel, Ind.). Such micropartic- derivatized with a variety of linkage lements. Preferably, for massively rticles, 5 m diameter GMA beads are |
Attaching Tags to Target Polynucleotides |
An important aspect of the invention is tion, e.g. a cDNA library, such that the polynucleotides. This latter condition c a repertoire of tags to a population of and sampling of the ligated sequences. A can be ligated to a population of polynu as through direct enzymatic ligation, am containing the tag sequences, and the li a very large population of tag-polynucle tag is generally attached to many differ a sufficiently small sample of the conju "doubles," i.e. the same tag on two diff negligible. (Note that it is also possib same polynucleotide in a sample. This ca being processed, e.g. sequenced, twice. are being analyzed, multiple tags with t occurence--and expected--because of diff more fully below, the probability of obt estimated by a Poisson distribution sinc will be large, e.g. on the order of thou of selecting a particular tag will be sm large, e.g. on the order of tens of thou of the tag repertoire is about 100 times polynucleotide in the population being a exity of the tag repertoire is preferabl of polynucleotides being analyzed. Gener the probability of obtaining a double. T selecting a large sample of tag-polynucl ensures adequate coverage of a target po operation, and selecting a small sample of doubles will be present. In most embo adds an additional source of noise or, i complication in scanning and signal proc simultaneously giving multiple signals c the term "substantially all" in referenc is meant to reflect the statistical natu to obtain a population of tag-molecule c The meaning of substantially all in term conjugates depends on how the tags are b acid sequencing, substantially all means tags have unique polynucleotides attache at least ninety percent of the tags have Still more preferably, it means that at have unique polynucleotides attached. An at least ninety-nine percent of the tags In a preferred embodiment, tags, polynuc sites, and other elements for manipulati a cloning vector to establish a base lib as needed. For example, such a construct where the "T" or tag primer binding site binding site are used with the appropria the cloning vector to form PCR amplicons sites are used to excise the tag from th ication and identification of a terminal amplifications, it is important that the from undesired cleavage by the nucleases Preferably, this is accomplished by meth iction endonucleases. |
tagging of polynucleotides of a popula- same tag is not attached to different an be essentially met by ligating polynucleotides followed by cloning repertoire of oligonucleotide tags cleotides in a number of ways, such plification, e.g. via PCR, using primers ke. The initial ligating step produces otide conjugates such that a single ent polynucleotides. However, by taking gates, the probability of obtaining erent polynucleotides, can be made le to obtain different tags with the se simply leads to a polynucleotide Also, where patterns of gene expression he same polynucleotide will be a common erences in mRNA abundances). As explain aining a double in a sample can be e the number of conjugates in a sample sands or more, and the probability all because the tag repertoire is sand or more. Preferably, the size the number of distinct species of nalyzed. Or, in other words, the compl- y about 100 times that of the population ally, the larger the sample the greater hus, a design trade-off exists between eotide conjugates--which, for example, lynucleotide in a shotgun sequencing which ensures that a minimal number diments, the presence of doubles merely n the case of sequencing, a minor essing, as regions of tag complements an simply be ignored. As used herein, e to attaching tags to polynucleotides re of the sampling procedure employed onjugates essentially free of doubles. s of actual percentages of tag-molecule eing employed. Preferably, for nucleic that at least eighty percent of the d. More preferably, it means that unique polynucleotides attached. least ninety-five percent of the tags d, most preferably, it means that have unique polynucleotides attached. leotides to be sequenced, primer binding ng the sequences are inserted into rary that may be sampled and amplified could have the following form: ##STR2## and the "S" or sequencing primer te primers to amplify the insert of for subsequent analysis. The cleavage e amplicons, after steps of PCR amplif- nucleotide. As noted below, after target polynucleotides be protected employed in the identification step. ylation and careful selection of restr- |
Sequencing Tagged Polynucleotides |
A preferred embodiment for simultaneousl polynucleotides is diagramed in FIG. 2a. polynucleotides is amplified from a vect of dATP, dCTP, dITP, and dTTP to give a (10) containing T primer binding site (1 below is optional, tag (16), cleavage si and rolling primer binding site (22). |
y sequencing a population of tagged Preferably, the population of tagged or as described above in the presence population of double stranded DNAs 2), cleavage site (14)--which as shown te (18), target polynucleotides (20), |
In the initial population, rolling prime complement to the extension region (24), example below. Samples of the initial po (26) to four separate vessels (28-34) wh primers of subgroup (1), described above -AIIC, -AIIG, and -AIIT. (The four rolli vessel and allowed to compete against on errors are less likely if the primers ar of subgroups (1)-(6) are used here to ex alternative forms of the rolling primers as described more fully below, the trans because more than four vessels, i.e. up exemplified here, are required for the e stranded DNAs (10) are combined with the wing steps (36) are taken: the double st heating; the temperature is lowered to p to the rolling primer binding sites; the fidelity DNA polymerase, such as Sequena dITP, and dTTP; preferably, any remainin e.g. with a single stranded nuclease, su the likelihood of interference from the subsequent amplification; T primer is ad products are amplified, preferably with A (38), amplicon C (40), amplicon G (42) As an alternative, and/or supplement, to stranded nuclease, the double stranded D (or equivalently, amplified in the prese After such treatment, any double strande least two extension reactions will be he at cleavage site (18). Thus, a nuclease sequences will not cleave it. If a sampl capture agent, such as biotin, on the T by cleaving with the nuclease for cleava that are methylated or hemi-methylated w signal upon application of the tags to a |
r binding site (22) contains a known for example, AGG as shown in the pulation are preferably transferred ere they are combined with the rolling , having extension regions -AIIA, ng primer could be placed in a single e another for extension; however, e used separately). The rolling primers emplify the invention. Clearly, many could be used. In subsequent cycles, ferring step (26) becomes more complex to 32 (=4.times.8) in the embodiment xtension reactions. After the double appropriate rolling primers the follo- randed DNAs are denatured, e.g. by ermit the rolling primers to anneal primers are extended with a high se, in the presence of dATP, dCTP, g single stranded DNA is digested, ch as Mung bean nuclease, to reduce left over single stranded DNA in the ded; and the double stranded extension 5-10 cycles of PCR, to generate amplicon , and amplicon T (44), respectively. the step of digesting with a single NA (10) can be treated with a methylase nce of 5-methylcytosine triphosphate). d DNA that is not the product of at mi-methylated or fully methylated that recognizes site (18) on those e of amplicon is taken by way of a primer, tags may be release for analysis ge site (18). However, those sites ill not be cleaved to give a spurious solid phase support (48). |
After a sample is taken from each amplic sites (14) and/or (18) and labeled (46), labeled tags are then either applied sep solid phase support (48) or pooled and a the labeling system employed, the comple factors. Samples of the amplicons are al in accordance with the method of the inv of the most recently determined nucleoti extension region, a sample either may be with rolling primers for the next cycle, one or more other samples and aliquotted for the next cycle. Unlike the single po of polynucleotides is sequenced every ve amplicon at the conclusion of the amplif digestion, and amplification, the amplic 34 correspond to target polynucleotides their initial positions (or more general to the rolling primer binding site), res and a knowledge of the sequence of the e the rolling primers of the next cycle ca cleotide case, in each successive cycle shifts, or advances, the rolling primer along the template in the direction of r a single nucleotide shift takes place in rolling primers selected for the extensi ion in the template upon amplification. nucleotide of the extension region to on positioning segment of the rolling prime below, the pattern of primer selection a 4 of a sequencing operation is illustrat first cycle, the original template is di tion and extension. ##STR3## The nucleot nucleotides in the second column is the primer used to produce the amplicon. Gen the rolling primers of the next cycle is distal to the terminal nucleotide in the primer (the leftmost "I" of the "IIA" se determine which nucleotide, I or A, is c with the terminal nucleotide (i.e. for t A, "A" for amplicon C--since A will pair G--since I will pair with C, and "I" for with A), (iii) insert the determined nuc terminal nucleotide. For this embodiment between extension region sequences is il regions lead to more complex patterns, b sible transitions remains the same. ##ST thirty-two reactions are required, and c until sequencing is halted. |
on, tags are excised by way of cleavage as described more fully below. The arately to their tag complements on pplied to the support, depending on xity of the tag mixture, and like so taken for further processing (50-56) ention. Depending on the identity de and the identity of the current separately aliquotted into vessels or a sample may be combined with into vessels with rolling primers lynucleotide case, when a population ssel will almost always contain an ication reaction. Thus, after extension, ons in the vessels 28, 30, 32, and having a T, G (or I), C, and A at ly, at the nucleotide position adjacent pectively. With this information, xtension region of the current amplicon, n be selected. As in the single polynu- a rolling primer is selected that binding site one or more nucleotides olling primer extension. Preferably, each cycle. As described above, the on step also serve to generate a mutat- The mutation changes the interior-most e that is complementary to the template r of the current cycle. In the tables nd amplicon pooling in cycles 2 through ed for the above embodiment. In the stributed to four vessels for denatura- ide to the right of the line between terminal nucleotide of the rolling erally, the algorithm for determining as follows: (i) drop the nucleotide extension region of the current rolling quences in the second column), (ii) omplementary to the nucleotide paired he above example: "A" for amplicon with I as well as C, "I" for amplicon amplicon T--since I will also pair leotide, I or A, to the left of the , the general pattern of transitions lustrated in FIG. 2b. Longer extension ut the basic algorithm defining permis- R4## Typically, by the eighth cycle ontinue to be required, in each cycle |
Clearly, additional steps to those outli example, to separate the initial extensi stranded DNA and/or the single stranded tion of polynucleotides and other reagen and the like, may be carried out on comm e.g. Biomek 1000 (Beckman Instruments, F |
ned above may be implemented, for on product from extraneous single nuclease, if one is employed. Manipula- ts, temperature control for PCRs, ercially available laboratory robots, ullerton, Calif.). |
Rolling primers and T primers may be con segment capable of binding to an anchore via triplex formation for separation, e. 65: 1323-1328 (1993); Cantor et al, U.S. Thus, for example, magnetic beads carryi ide can be used to capture the amplicons containing a nuclease to cleave the tag, double stranded DNAs that have been sele unamplified and therefore hemi-methylate the T primer contains a 5' biotin which and conveniently labeled. After capture, the 3' strands of the double stranded se by the use of T4 DNA polymerase, or like leoside triphosphate (dNTP) correspondin Thus, provided that the flanking nucleot the strand to the 3' ends, the 3'.fwdarw rase will strip back the 3' strand to th an exchange reaction will be initiated t the flanking nucleotides. The 3' ends of extension reaction with labeled dNTPs. A strand can be removed by denaturation an array for detection. |
structed to have a double stranded d single stranded oligonucleotide g. as taught by Ji et al, Anal. Chem. Pat. No. 5,482,836; or the like. ng such a single stranded oligonucleot- and transfer them to a separate vessel e.g. at cleavage site 18, of those ctively amplified (other DNAs remain d so no cleavage occurs). Preferably, permits the released tag to be captured e.g. via avidinated magnetic beads, gment are stripped back to the tag enzyme, in the presence of a deoxynuc- g to the nucleotide flanking the tag. ides are not present elsewhere along .5' exonuclease activity of the polyme- e flanking nucleotides, at which point hat prevents further stripping past the tag can then be labeled in an fter labeling the non-biotinylated d applied to the spatially addressable |
After the labeled tags are hybridized to the tags are removed by washing so that amplicons can be applied. |
their tag complements and detected, labeled tags from the next set of |
Apparatus for Observing Detection Signal |
s at Spatially Addressable Sites |
Preferably, a spatially addressable arra containing tag complements to a solid ph may be used to detect hybridized tags an whenever light-generating signals, e.g. the like, are employed. For example, a s in International patent applications PCT S95/01886, may be employed. Preferably, nts are loaded as a fluid-particle slurr held in place by a combination of nonspe article to the substrate and a gentle fl a dam in the flow chamber. An exemplary Flow chamber (500) is prepared by etchin and outlet (504) in a glass plate (506) es, e.g. Ekstrom et al, International pa U.S. Pat. No. 4,911,782; Harrison et al, and the like. The dimension of flow cham rticles (508), e.g. GMA beads, may be di packed planar monolayer of 100-200 thous a closed chamber with inlet and outlet b slip (512) onto the etched glass plate ( 3,397,279. With the glass cover slip in few tens of percent greater than the dia loaded to ensure that a monolayer is for (504) is present in glass plate (506) is ticles in the slurry, but at the same ti or other reagents, to pass freely. Reage from syringe pumps (514 through 520) thr by a microprocessor as is commonly used ers, e.g. Bridgham et al, U.S. Pat. No. 4,252,769; Barstow et al, U.S. Pat. No. No. 4,703,913; or the like. |
y is established by fixing microparticle ase surface. A variety of apparatus d/or enzymatic events on such an array chemiluminescent, fluorescent, or canning system, such as described /US91/09217, PCT/NL90/00081, and PCT/U- microparticles containing tag compleme- y into a flow chamber where they are cific binding of the DNA on the microp- ow which pushes the particles against apparatus is illustrated in FIG. 3: g a cavity having a fluid inlet (502) using standard micromachining techniqu- tent application PCT/SE91/00327; Brown, Anal. Chem. 64: 1926-1932 (1992); ber (500) are such that loaded micropa- sposed in cavity (510) in a closely and beads. Cavity (510) is made into y anodic bonding of a glass cover 506), e.g. Pomerantz, U.S. Pat. No. place cavity (510) has a height a meter of the microparticles being med. A dam or shelf adjacent to outlet which forms a barrier to the micropar- me allows fluid component of the slurry, nts are metered into the flow chamber ough valve block (522) controlled on automated DNA and peptide synthesiz- 4,668,479; Hood et al, U.S. Pat. No. 5,203,368; Hunkapiller, U.S. Pat. |
Specifically hybridized tags are detecte with illumination beam (524) from light mercury arc lamp, or the like. Illuminat (528) and excites the fluorescent labels dized to tag complements in flow chamber is collected by confocal microscope (532 directed to CCD camera (536), which crea array for processing and analysis by wor about a 25 nM concentration are passed t rate of 1-2 .mu.L per minute for 10 minu buffer consisting of 50 mM NaCl, 3 mM Mg fluorescent labels carried by the tags a collected. The tags are melted from the buffer through the flow chamber at a flo 55.degree. C. for 10 minutes. |
d by exciting their fluorescent labels source (526), which may be a laser, ion beam (524) passes through filter on tag complements specifically hybri- (500). Resulting fluorescence (530) ), passed through filter (534), and tes an electronic image of the bead kstation (538). Preferably, tags at hrough the flow chamber at a flow tes at 20.degree. C. in a hybridization , 10 mM Tris-HCl (pH 8.5), after which re illuminated and fluorescence is tag complements by passing hybridization w rate of 1-2 .mu.L per minute at |
In sequencing applications, microparticl a substrate in variety of ways. The fixa the microparticles to undergo successive without significant loss. When the subst derivatized with an alkylamino linker us e.g. Pierce Chemical, which in turn may conventional chemistries, to form an avi be introduced to the microparticles in a |
es can be fixed to the surface of tion should be strong enough to allow cycles of reagent exposure and washing rate is glass, its surface may be ing commercially available reagents, be cross-linked to avidin, again using dinated surface. Biotin moieties can number of ways. |
Kits for Implementing the Method of the |
Invention |
The invention includes kits for carrying invention. Preferably, kits of the inven for carrying out the extensions and ampl invention. Kits may also include a reper to a solid phase support. Additionally, the corresponding repertoire of tags, e. ucleotides to be sorted or as elements o repertoire of tag complements are attach contain appropriate buffers for enzymati e.g. fluorescent or chemiluminescent com like, instructions for use, processing e transferases, and so on. In an important also include substrates, such as a avidi plates, for fixing microparticles for pr |
out the various embodiments of the tion include a set of rolling primers ifications in accordance with the toire of tag complements attached kits of the invention may include g. as primers for amplifying the polyn- f cloning vectors. Preferably, the ed to microparticles. Kits may also c processing, detection chemistries, ponents for labelling tags, and the nzymes, such as ligases, polymerases, embodiment for sequencing, kits may nated microscope slides or microtiter ocessing. |
EXAMPLE 1 |
Construction of a Tag Library |
An exemplary tag library is constructed synthesized 9-word tags of nucleotides A 3'-TGGC-›.sup.4 (A,G,T).sub.9 !-CCCCp |
as follows to form the chemically , G, and T defined by the formula: |
where "›.sup.4((A,G,T).sub.9 !" indica sts of nine 4-mer words of A, G, and T; mixture is ligated to the following righ (SEQ ID NO: 10 and SEQ ID NO: 11): |
tes a tag mixture where each tag consi- and "p" indicate a 5' phosphate. This t and left primer binding regions |
____________________________________ |
__ |
5'- AGTGGCTGGGCATCGGACCG |
5'- GGGGCCCAGTCAGCG |
TCGAT |
TCACCGACCCGTAGCCp |
GGGTCAGTCGCAGCTA |
LEFT |
RIGHT |
____________________________________ |
__ |
The right and left primer binding region after which the single stranded portion with DNA polymerase then mixed with the and amplified to give a tag library. |
s are ligated to the above tag mixture, of the ligated structure is filled right and left primers indicated below |
____________________________________ |
______________________________________ |
Left primer: |
5'40 - AGTGGCTGGGCATCGGACCG |
5'40 - AGTGGCTGGGCATCGGACCG- |
›.sup.4( (A, |
G, T).sub.9 !- |
GGGGCCCA |
GTCAGCGTCGAT |
TCACCGACCCGTAGCCTGGC- |
›.sup.4( (A, G, |
T).sub.9 !- |
CCCCGGGT |
CAGTCGCAGCTA |
CCCCGGGTCAGTCGCAGCTA-5' |
Right p |
rimer |
____________________________________ The underlined portion of the left prime recognition site. The left-most underlin region indicates recognition sites for B a cleavage site for Hga I. The right-mos binding region indicates the recognition or left primers may be synthesized with reagents, e.g. available from Clontech L facilitate purification after amplificat |
______________________________________- r binding region indicates a Rsr II ed region of the right primer binding sp 120I, Apa I, and Eco O 109I, and t underlined region of the right primer site for Hga I. Optionally, the right a biotin attached (using conventional aboratories, Palo Alto, Calif.) to ion and/or cleavage. |
EXAMPLE 2 |
Construction of a Plasmid Library of Tag "Signature" Sequencing |
-Polynucleotide Conjugates for cDNA |
cDNA is produced from an mRNA sample by (A or G or C) as a primer for first stra of the poly A region of the mRNAs and N. second strand synthesis. That is, both a second strand primer is present in two f present in three forms. The GATC sequenc nds to the recognition site of Mbo I; ot be used as well, such as those for Bam H presence of the A and T adjacent to the primer ensures that a stripping and exch step to generate a five-base 5' overhang is annealed to the mRNA sample and exten which the RNA strand is degraded by the riptase leaving a single stranded cDNA. and extended with a DNA polymerase using strand synthesis, the resulting cDNAs ar England Biolabs, Beverly, Mass.) using m of the cDNAs are then cut back with the reaction using T4 DNA polymerase in the the cDNAs are ligated to the tag library Hga I to give the following construct: # cloning vector (SEQ ID NO: 12) is constr available plasmid, such as a Bluescript ##STR6## The rolling primer binding site subgroup (1), described above. The plasm I (to give a Rsr II-compatible end and a ted) and then methylated with DAM methyl is cleaved with Rsr II and then ligated conjugate is cleaved with Mbo I and Bam of the plasmid. The plasmid is then ampl for extensions and amplifications in acc |
conventional protocols using pGGCCCT.sub.15 nd synthesis anchored at the boundary sub.8 (A or T)GATC as the primer for re degenerate primers such that the orms and the first strand primer is e in the second strand primer correspo- her four base recognition sites could 1, Sph I, Eco RI, or the like. The restriction site of the second strand ange reaction can be used in the next of "GGCCC". The first strand primer ded with reverse transcriptase, after RNase H activity of the reverse transc- The second strand primer is annealed conventional protocols. After second e methylated with CpG methylase (New anufacturer's protocols. The 3' strands above-mentioned stripping and exchange presence of dATP and dTTP, after which of Example 1 previously cleaved with #STR5## Separately, the following ucted, e.g. starting from a commercially phagemid (Stratagene, La Jolla, Calif.). corresponds to a rolling primer of id is cleaved with Ppu MI and Pme flush end so that the insert is orien- ase. The tag-containing construct to the open plasmid, after which the HI to permit ligation and closing ified and isolated for use as a template ordance with the invention. |
EXAMPLE 3 |
Signature Sequencing of a cDNA Library |
The plasmid constructed in Example 2 is and amplicons with the rolling primers d primer (SEQ ID NO: 13): |
used for generating extension products escribed above and the following T |
biotin-5'-IIIIIIIIAAAAGGAGGAGGCCTTGA |
where the I's are deoxyinosines added to temperatures of the T primers and rollin temperature is about 55.degree. C. Clear employed in the implementation of the in above are employed. |
balance the annealing and melting g primers. Preferably, the annealing ly, many other sequences could be vention. The rolling primers described |
The segment containing the T primer bind binding site is excised and separated fr can be accomplish in a variety of ways k example, engineering the plasmid to cont segment, or by simply amplifying directl ines with deoxyinosines, e.g. by PCR in is aliquotted into four vessels, denatur is added. Conditions are adjusted to per after which the primers are extended wit polymerase, in the presence of dATP, dCT rer's protocol. The remaining single str stranded nuclease, such as Mung bean nuc DNA extension product may be separated f capture via the formation of a triplex b binding region, and an appropriate singl a magnetic bead. |
ing site through the rolling primer om the plasmid of example 2. (This now to those skilled in the art, for ain restriction sites flanking the y by PCR). After replacing deoxyguanos- the presence of dITP, the segment ed, and the appropriate rolling primer mit the rolling primers to anneal, h Sequenase, or like high fidelity P, dITP, and dTTP, using the manufactu- anded DNA is digested with a single lease. Optionally, the double stranded rom the reaction mixture, e.g. by etween, for example, the T primer e stranded complement attached to |
The double stranded DNA is combined with separation step was used) and amplified of dATP, dCTP, dITP, and dTTP to form th of these are combined and re-distributed rolling primers for the next cycle of ex for analysis. |
T primer (and rolling primer if a by 5-10 cycles of PCR in the presence e four initial amplicons. Samples into vessels with the appropriate tension. Samples are also drawn off |
Preferably, the samples for analysis are carrying a single stranded sequence that The beads are then transferred to reacti cleaves the tags from the target polynuc ID NO: 14) containing the tags are next primers with magnetic beads coated with vessels where their 3' ends are stripped and dGTP, as shown below: |
separately captured on magnetic beads forms a triplex with the S primers. on mixtures containing Apa I, which leotide. The released strands (SEQ captured via their biotinylated T avidin and transferred to reaction in the presence of T4 DNA polymerase |
After cleavage with Apa I: |
____________________________________ |
______________________________________ |
bi |
otin-5'40 -IIIIIIII›AG!.sub.12 |
TAGAGAGGACCG› TAGS !GGGGCC |
CCCCCCCC›TC!.sub.12 ATCT |
CTCCTGGC› SGAT !CC |
.dwnarw. |
T4 polymerase + dGTP |
biotin-5'40 - IIIIIIII›AG!.sub.1 |
2 TAGAGAGGACCG› TAGS !GG |
G |
GC› SGAT !CC |
.dwnarw. |
Add dUTP*, dCTP ddATP |
biotin-5'40 - IIIIIIII›AG!.sub.1 |
2 TAGAGAGGACCG› TAGS !GG |
dAUCUCUCCUG |
GC› SGAT !CC |
* * * * |
.dwnarw. |
Heat denature |
dAUCUCUCCUGGC› |
SGAT !CC-5'40 |
* * * * |
____________________________________ Here dUTP* represents a labeled dUTP and triphosphate. Preferably, dUTP is labele fluorescent dye for each of the four amp NO: 15) for each of the amplicon are mix addressable array for hybridization to t |
______________________________________- ddATP represents dideoxyadenosine d with a separate spectrally resolvable licons. The released tags (SEQ ID ed and are applied to the spatially heir complements and detection. |
Example 4 |
Sequencing a Target Polynucleotide with |
Conversion to RNA |
In this example, a dsDNA template is seq embodiment employing cyclical conversion vector (SEQ ID NO: 16) is prepared from pUC 19, by inserting a T7 promoter eleme primer binding site (single underline) i of the polylinker region: ##STR7## After into the Bam HI site, the beginning temp RNA transcription takes place after the with HinD III. FIGS. 2a and 2b illustrat of the template and rolling primer bindi eight cycles. In each cycle a single nuc Arrows (210) indicate the nucleotide pos and the double underlined nucleotide of the resulting change. In this example, t with the indicated extension regions are (Promega, Madison, Wis.). Lower case "a" oxo-A, and lower case "g" in the extensi cation step is carried out with PCR usin ining the T7 promoter element (underline primers: |
uenced with rolling primers in the of the template into RNA. The following a standard cloning vector, such as nt (double underline) and a rolling nto the indicated restriction sites insertion of a target polynucleotide late (200) of FIG. 2a is obtained. vector has been linearized by cleaving e the changes that occur in sequences ng site as the process is taken through leotide in the template is identified. itions where mutations take place, the "converted template" indicates he p1 and p2 primers described above employed with reverse transcriptase in the extension region indicates on region indicates oxo-G. The amplifi- g a forward primer (shown below) conta- d) and the following p1 and p2 reverse |
Forward primer (SEQ ID NO: 17): |
5'-AATTTAATACGACTCACTATAGGGAGAATTCGAGCTC |
GGTACCCGGG |
p1 reverse primer (SEQ ID NO: 18): |
5'-IGIGGIGTGTITTTTTIGIGG |
p2 reverse primer (SEQ ID NO: 19): |
5'-IGIGGITGTGTITTTTIGIGG |
RNA is produced from the dsDNA template (Promega, Madison, Wis.) using the manuf 50 .mu.l reaction volume, 0.1 pmol of ds T7 RNA polymerase, 1.5 U/.mu.l human pla 19 U/.mu.l inorganic pyrophosphatase and C. for 2-4 hours in transcription buffer MgCl.sub.2, 2 mM spermidine-HCl, 40 mM D cleoside triphosphates). After adding 47 MnCl.sub.2 and heating at 65.degree. C. I (U.S. Biochemical) is added and the mi for 30 min. RNA is then purified from th (Santa Clarita, Calif.) RNA purification Four separate reverse transcription reac ing a 1-10 pmol aliquot of the transcrib rolling primer labeled with fluorescein, Corp. Applied Biosystems Division, Foste 65.degree. C. for 5 min. to denature the on ice and reverse transcriptase (0.1 U/ is added in a buffer consisting of 50 mM 50 mM NaCl , 10 mM DTT, and 25-50 .mu.M osphates, so that a reaction volume of 1 mixtures are incubated at 50-55.degree. incubated at 95.degree. C. for 5 min., t remaining RNA. The four reaction mixture a 3'-terminal A, C, G, and T, respective of the four reactions will result in the The product is identified by separating phoresis, after which the band containin and the ssDNA recovered. |
with a RiboMax RNA production system acturer's protocol. Briefly, in a DNA template is combined with 30 U/.mu.l cental ribonuclease inhibitor, and the mixture is incubated at 37.degree. (80 mM HEPES-KOH (pH 7.5), 24 mM TT, and 7.5 mM each of the four ribonu- .mu.l H.sub.2 O and 1 .mu.l 100 mM for 5 min., 2 .mu.l (4.2 U) of DNase xture is incubated at 37.degree. C. e reaction mixture using a QIAGEN system (elution volume 30 .mu.l). tion mixtures are formed, each contain- ed RNA and 5 pmol of the appropriate e.g FAM (available form Perkin-Elmer r City, Calif.). After heating to RNA, the reaction mixture is cooled .mu.l) and RNase inhibitor (0.85 U/.mu.l) Tris-HCl (pH 8.1), 8 mM MgCl.sub.2, each of the four deoxynucleoside triph- 0 .mu.l is obtained. The reaction C. for 5 min., after which they are hereby effectively destroying any s correspond to rolling primers with ly. Thus, in each cycle, only one synthesis of a ssDNA extension product. the reaction components by gel electro- g the extension product is excised |
The dsDNA template is re-formed by ampli in a conventional PCR using the primers |
fying the ssDNA extension product listed above. |
EXAMPLE 5 |
Effect of dNTP Concentration on Primer S |
election on an RNA Template |
In this example, the affect of different ations on primer selection was examined primer selection, and amplification. The out as described in Example 4, with the employed a mixture of four primers each, A's, C's, G's and T's competed against o transcriptase at the indicated concentra in FIGS. 5a-5c, show that dNTP concentra to the greatest selectivity in primer ex For FIG. 5a the correct primer was the f |
deoxynucleoside triphosphate concentr- through three cycles of RNA synthesis, steps of each cycle were carried exception that the extension reactions so that the primers having 3'-terminal ne another for extension by reverse tions of dNTPs. The results, illustrated tions at about 50 .mu.M or below lead tension by reverse transcriptase. ollowing: |
5'- . . . GIGaTC . . . CCCUAGagaa . . . |
For FIG. 5b, the correct primer was the |
following: |
5'- . . . GIDgCT . . . CCCUAGAgaa . . . |
For FIG. 5c the correct primer was the f |
ollowing: |
5'- . . . GIGaTC . . . CCCUCGAGaa . . . |
____________________________________ |
______________________________________ |
# SEQUENCE LISTING |
- (1) GENERAL INFORMATION: |
- (iii) NUMBER OF SEQUENCES: 19 |
- (2) INFORMATION FOR SEQ ID NO: 1: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 22 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#1: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 22ANN NN |
- (2) INFORMATION FOR SEQ ID NO: 2: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 22 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#2: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 22GNN NN |
- (2) INFORMATION FOR SEQ ID NO: 3: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 22 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#3: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 22GNN NN |
- (2) INFORMATION FOR SEQ ID NO: 4: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 22 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#4: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 22ANN NN |
- (2) INFORMATION FOR SEQ ID NO: 5: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 22 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#5: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 22ANN NN |
- (2) INFORMATION FOR SEQ ID NO: 6: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 22 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#6: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 22GNN NN |
- (2) INFORMATION FOR SEQ ID NO: 7: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 26 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
- (ix) FEATURE: |
(A) NAME/KEY: primer |
# a.B) LOCATION: n. |
(C) IDENTIFICATION METHOD: |
- # n.a. |
#first "N" is preferably deoxyinosin |
e |
#7: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 26 GGGG GNNNNN |
- (2) INFORMATION FOR SEQ ID NO: 8: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 26 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
- (ix) FEATURE: |
(A) NAME/KEY: primer |
(B) LOCATION: n.a. |
(C) IDENTIFICATION METHOD: |
- # n.a. |
#first and second "N's" are preferab |
ly |
deoxyinosine |
#8: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 26 GGGG GNNNNN |
- (2) INFORMATION FOR SEQ ID NO: 9: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 25 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#9: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 25 CTTC CNNNN |
- (2) INFORMATION FOR SEQ ID NO: 10: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 20 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: doub - |
#le |
(D) TOPOLOGY: linear |
#10: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 20 ACCG |
- (2) INFORMATION FOR SEQ ID NO: 11: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 20 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: doub - |
#le |
(D) TOPOLOGY: linear |
#11: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 20 CGAT |
- (2) INFORMATION FOR SEQ ID NO: 12: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 62 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: doub - |
#le |
(D) TOPOLOGY: linear |
#12: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 50TTGATA GAGAGGACCT G |
TTTAAACGG ATCCGCTGCT |
# 62 |
- (2) INFORMATION FOR SEQ ID NO: 13: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 26 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#13: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 26 GAGG CCTTGA |
- (2) INFORMATION FOR SEQ ID NO: 14: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 43 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: doub - |
#le |
(D) TOPOLOGY: linear |
#14: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 43 AGAG GAGAGAGAGA G |
TAGAGAGGA CCG |
- (2) INFORMATION FOR SEQ ID NO: 15: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 12 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#15: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 12 |
- (2) INFORMATION FOR SEQ ID NO: 16: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 104 nucleot - |
#ides |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#16: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 50CACTAT AGGGAGAATT C |
GAGCTCGGT ACCCGGGGAT |
# 100CACACC CCCGTCGACC T |
GCAGGCATG CAAGCTTGGC |
# 104 |
- (2) INFORMATION FOR SEQ ID NO: 17: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 47 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#17: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
# 47CTAT AGGGAGAATT C |
GAGCTCGGT ACCCGGG |
- (2) INFORMATION FOR SEQ ID NO: 18: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 21 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#18: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
#21 NGNG G |
- (2) INFORMATION FOR SEQ ID NO: 19: |
- (i) SEQUENCE CHARACTERISTICS: |
(A) LENGTH: 21 nucleoti - |
#des |
(B) TYPE: nucleic acid |
(C) STRANDEDNESS: sing - |
#le |
(D) TOPOLOGY: linear |
#19: (xi) SEQUENCE DESCRIPTION: SEQ |
ID NO: |
#21 NGNG G |
____________________________________ * * * * * |
______________________________________- |